Streams and LambdaExpressions in Java 8

Introduction
Typical processing patterns on collections were very hard up until Java 8 introduced a new abstraction called a Stream. Stream operations are chained together into pipelines. Other than that lambda expressions (JSR335) facilitate functional programming and simplifies the development a lot.

Workshop
For an example consider the following real world use case. Suppose we have university system where an instructor can deliver questions (multiple choice) to students. Then students start responding the question with answers. The instructor needs to find following abstract information out of all the responses.

  • Percentage of correct responses.
  • Assuming that the multiple choice question has four answer options, how many students have chosen each option.

If you implement this by following orthodox way, you may end up with many lines of code  blocks. That’s where Java8 comes to the rescue. By combining Java8 streams and lambda functions you can write each usecase in one single line of code. Suppose following Response model class get hold of all the student responses in out system.

The main method to find above abstract information can be written using java8 streams and lambda functions as follows.

Summary
In this blogpost we walked through some salient features of Java8, such as Streams and lambda expressions and realized the importance of those. I hope you enjoyed it. I’ll see you in my next blog post.

References
[3]http://www.oracle.com/webfolder/technetwork/tutorials/obe/java/Lambda-QuickStart/index.html#overview

 

Comments

Post a Comment

Popular posts from this blog

Introducing Java Reactive Extentions in to a SpringBoot Micro Service

Image
Introduction Today we are going to take a look at Reactive Programming using Java8 and RxJava, which is a library for composing asynchronous and event-based programs by using observable sequences. RxJava stands for Reactive Extensions for the JVM. It extends the observer pattern [Gamma95] to support sequences of data/events and adds operators that allow you to compose sequences together declaratively while abstracting away concerns about things like low-level threading, synchronization, thread-safety and concurrent data structures [1]. Pre-Requisites : Having a good knowledge about Java8, Functional Programming and spring boot microservices. What is Reactive programming? In essence, Reactive programming is an asynchronous programming paradigm concerned with data streams. The system time, a list of entries from the DB/API, user clicks, everything can be a stream of data. Data from different streams can easily be combined and transformed, and in the end processed/observed by the
Read more

Optimal binary search trees

Image
Suppose that we are designing a program to translate text from English to French. For each occurrence of each English word in the text, we need to look up its French equivalent. We could perform these lookup operations by building a binary search tree with $n$ English words as keys and their French equivalents as satellite data. Because we will search the tree for each individual word in the text, we want the total time spent searching to be as low as possible. We could ensure an $Θ(log_2 \;n)$ search time per occurrence by using a red-black tree or any other balanced binary search tree. Words appear with different frequencies, however, and a frequently used word such as the may appear far from the root while a rarely used word appears near the root. Such an organization would slow down the translation, since the number of nodes visited when searching for a key in a binary search tree equals one plus the depth of the node containing the key. We want words that occur frequently in the t
Read more

Edit distance

Image
Biological applications often need to compare the DNA of two (or more) different organisms. A strand of DNA consists of a string of molecules called bases, where the possible bases are adenine, guanine, cytosine, and thymine. Representing each of these bases by its initial letter, we can express a strand of DNA as a string over the finite set $\{A, C, G, T\}$. For example, the DNA of one organism may be $S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA$, and the DNA of another organism may be $S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA$. One reason to compare two strands of DNA is to determine how “similar” the two strands are, as some measure of how closely related the two organisms are. We can, and do, define similarity in many different ways. For example, we can say that two strands are similar if the number of changes needed to turn one into the other is small. [1] We formalize this notion of similarity in our Edit distance problem. 15-5 Edit distance - Problem Statement In order to transform one sour
Read more